[Advance of research on the role of BCL11A in the occurrence and treatment of ß-Thalassemia].

ß-Thalassemia is a single-gene disease caused by mutations in ß-globin and has a distinct geographical characteristics. Current treatment for patients with moderate to severe thalassemia has mainly relied on long-term blood transfusion and/or hematopoietic stem cell transplantation. B cell lymphoma/leukemia 11A (BCL11A) as a transcriptional repressor plays a vital role in monitoring γ/ß hemoglobin switching, maintaining the normal function of hematopoietic stem cells, and regulating erythrocyte differentiation and lymphocyte development. With the rapid progress in gene editing technology, the BCL11A as a therapeutic target for ß-thalassemia has shown promising results. This article has systematically summarized the regulatory mechanism and therapeutic potential of the BCL11A, with an aim to provide new ideas for the treatment of ß-thalassemia.

[Study of the types of mutations of Thalassemia in Shanghai area].

OBJECTIVE: To analyze the mutations of globin genes among patients suspected for thalassemia from the Shanghai area. METHODS: A total of 4 644 patients diagnosed at Ruijin Hospital, Shanghai Jiao Tong University School of Medicine between June 2016 and December 2019 were selected as the study subjects. The patients were tested for common mutations associated with thalassemia gene by Gap-PCR and reverse dot blotting (RDB). Patients were suspected to harbor rare mutations based on the inconsistency between hematological phenotypes and results of common mutation detection, and were further analyzed by Gap-PCR and Sanger sequencing. RESULTS: Among the 4 644 patients, 2 194 (47.24%) were found to carry common thalassemia mutations, among which 701 (15.09%) were α-thalassemia, 1 448 (31.18%) were ß-thalassemia, and 45 (0.97%) were both α- and ß-thalassemia. Forty six samples were found to harbor rare mutations, which included 17 α-globin gene and 29 ß-globin gene mutations. CD77(CCC>ACC) (HBA2: c.232C>A) of the α-globin gene, NG_000007.3: g.70567_71015del449, codon 102(-A) (HBB: c.308_308delA) and IVS-Ⅱ-636 (A>G) (HBB: c.316-215A>G) of the ß-globin gene were previously unreported new types of globin gene mutations. CONCLUSION: Among the 4 644 patients, the detection rate for common thalassemia mutations was 47.24%, whilst 46 samples were detected with rare gene mutations. The type of gene mutation types were diverse in the Shanghai area. The study has provided more accurate results for genetic diagnosis and counseling.

Abnormal hemoglobin anti-Lepore Hong Kong compound with ß0-thalassemia ameliorate thalassemia severity when co-inherited with α-thalassemia.

Abnormal hemoglobin anti-Lepore Hong Kong is a rare ßδ fusion variants resulting from non-homologous crossover during meiosis. Anti-Lepore Hong Kong is known to consistently exhibit significantly increased level of HbA2. In this study, we used multiplex ligation-dependent probe amplification (MLPA) and single molecular real-time (SMRT) sequencing, as well as Sanger sequencing, to identify variants in five unrelated families with abnormal elevated HbA2 level. All probands in these five families were found to be heterozygous for anti-Lepore Hong Kong. Among them, two families showed co-occurrence of ß0-thalassemia and α-thalassemia (-SEA/ or αCSα/). Heterozygotes for anti-Lepore Hong Kong displayed an average HbA2 level of 17.7% and behaved normal. However, when combined with ß0-thalassemia and α-thalassemia, the probands exhibited higher HbA2 level (30.2-40.8%) and behaved with ß-thalassemia trait. Furthermore, determination of the α/ß-mRNA ratio revealed a slight downregulation of ß-globin, similar to that of ß-thalassemia minor. Our study is the first to identify compound heterozygotes for anti-Lepore Hong Kong, ß0-thalassemia and α-thalassemia, provide valuable information for prenatal counseling.

ß0-Thalassemia Caused by a Novel Nonsense Mutation [HBB:c.199A > T].

We report two hemoglobinopathy cases involving a novel ß-thalassemia (ß-thal) nonsense mutation, HBB:c.199A > T. One patient had Hb S/ß-thal, and a second unrelated patient had Hb D-Punjab/ß-thal. The HBB:c.199A > T mutation introduces a premature termination codon at amino acid codon 66 (AAA→TAA) in exon 2, resulting in typical high Hb A2 ß0-thal.

RNA therapeutics for ß-thalassemia.

ß-thalassemia is an autosomal recessive disease, caused by one or more mutations in the ß-globin gene that reduces or abolishes ß-globin chain synthesis causing an imbalance in the ratio of α- and ß-globin chain. Therefore, the ability to target mutations will provide a good result in the treatment of ß-thalassemia. RNA therapeutics represents a promising class of drugs inclusive antisense oligonucleotides (ASO), small interfering RNA (siRNA), microRNA (miRNA) and APTAMER have investigated in clinical trials for treatment of human diseases as ß-thalassemia; Especially, ASO therapeutics can completely treat ß-thalassemia patients by the way of making ASO infiltrating through erythrocyte progenitor cells, migrating to the nucleus and hybridizing with abnormal splicing sites to suppress an abnormal splicing pattern of ß-globin pre-mRNA. As a result, the exactly splicing process is restored to increase the expression of ß-globin which increases the amount of mature hemoglobin of red blood cells of ß-thalassemia patients. Furthermore, current study demonstrates that RNA-based therapeutics get lots of good results for ß-thalassemia patients. Then, this chapter focuses on current advances of RNA-based therapeutics and addresses current challenges with their development and application for treatment of ß-thalassemia patients.

A 6-Year Follow-up of a Chinese Child with Homozygous ß0-Thalaasemia and a Heterozygous KLF1 Mutation.

Patients with the genotype of ß0/ß0 for ß-thalassemia (ß-thal) usually behave as ß-thal major (ß-TM) phenotype which is transfusion-dependent. The pathophysiology of ß-thal is the imbalance between α/ß-globin chains. The degree of α/ß-globin imbalance can be reduced by the more effective synthesis of γ-globin chains, and increased Hb F levels, modifying clinical severity of ß-TM. We report a Chinese child who had homozygous ß0-thal and a heterozygous KLF1 mutation. The patient had a moderate anemia since 6 months old, keeping a baseline Hb value of 8.0-9.0 g/dL. She had normal development except for a short stature (3rd percentile) until 6 years old, when splenomegaly and facial bone deformities occurred. Although genetic alteration of KLF1 expression in ß0/ß0 patients can result in some degree of disease alleviation, our case shows that it is insufficient to ameliorate satisfactorily the presentation. This point should be borne in mind for physicians who provide the genetic counseling and prenatal diagnosis to at-risk families.

Molecular characterisation of sickle cell disease and classification of major haplotypes associated with the ß-globin cluster (HBB gene) by means of SNP marker sequencing in a group of samples from Bolívar, Colombia.

BACKGROUND: Colombia has a mestizo population and the prevalence of haemoglobin variants varies according to each region, but heterozygous carriers can be found in all of them. AIM: To characterise sickle cell disease (SCD) haematologically, biochemically, and molecularly, and detect classic haplotypes by DNA sequencing in a group of samples from Bolívar, Colombia. SUBJECTS AND METHODS: Blood samples were collected after informed consent from volunteers from eight communities in the Bolívar department, plus samples from the Pacific region, Providencia Island, and Bogotá were included. Data were obtained from: (1) haematological analyses; (2) biochemical tests: dHPLC was used to determine haemoglobin (Hb); and (3) DNA sequencing data through five SNPs. RESULTS: 101 samples were identified by rs334 through Sanger's Sequencing, structural haemoglobinopathies HbAS (34.65%), HbSS (2.97%) and HbAC (1.98%) were found. When contrasting the Hb identification results between SNP rs334 Vs. dHPLC/Isoelectric Focusing (IEF), a coincidence was found in 39/43 samples analysed, therefore, when comparing these techniques, a significant correlation was found (Pearson's correlation coefficient r = 0.998). 26 samples previously analysed by rs334 were classified into classical haplotypes CAR (50.0%), BEN (30.76%), CAM (7.69%), SEN (3.84%), and ATP-I (7.69%). CONCLUSIONS: SCD characterisation and SNPs-based classification through Sanger's DNA sequencing have not been performed before in Colombia. The results of this work will make it possible to expand the data or records of carriers and those affected, which will benefit patients and their families.

Identification of a Novel Variant c.163delG in HBB Gene Resulting in a Beta Null Phenotype in a Proband with Thalassemia Intermedia.

A 21-year-old patient presented with a previous medical history of pallor, mild icterus, increased fatigue, low hemoglobin, and abnormal hemoglobin variant analysis with more than 70 transfusions. He was referred for genetic analysis to identify the pathogenic variations in the ß-globin gene. Sanger's sequencing of the proband and his family revealed the presence of a novel frame shift variant HBB:c.163delG in a compound heterozygous state with hemoglobin E (HbE) (HBB:c.79G > A) variant. The father and the sibling of the patient were found to be normal for the HBB gene. Mother was found to be heterozygous for HbE (HBB:c.79G > A) variant. In silico analysis by Mutalyzer predicted that c.163delG variant generated a premature stop codon after seven codons, leading to a truncated protein. FoldX protein stability analysis showed a positive ΔΔG value of 45.27 kcal/mol suggesting a decrease in protein stability. HBB:c.79G > A is a known variant coding for HbE variant, which results in the reduced synthesis of ß-globin chain and shows mild thalassemia. Combined effect of HBB:c.163delG and HBB:c.79G > A variants in the proband might have led to the reduced synthesis of ß-globin chains resulting in a thalassemia intermedia type of clinical manifestation.

Genetic epidemiology of thalassemia in couples of childbearing age: over 6 years of a thalassemia intervention project.

BACKGROUND: Shenzhen is one of the most populated metropolises in southern China where thalassemia is highly prevalent. The prevention of thalassemia inheritance is an ambition of child-bearing couples. METHODS AND RESULTS: A total of 22,098 peripheral blood samples were collected from 11,049 potentially at-risk couples of childbearing age from Shenzhen. Thalassemia mutations were determined by PCR-based flow-through hybridization. The results identified 45.02% of the participants (9948 out of 22,098) as harboring globin gene mutations, distributed into 18 α-thalassemia alleles detected in 71.48% (7111 out of 9948) and 15 ß-thalassemia alleles detected in 32.68% (3252 out of 9948) of all mutant individuals, among which 415 individuals carried both α- and ß-thalassemia alleles. The most frequent phenotypes for α-globin variations were --SEA/αα (63.37%), -α3.7/αα (18.66%), and -α4.2/αα (7.31%), and those for ß-globin variations were ß41-42/ßN (34.96%), ß654/ßN (28.11%), and ß17/ßN (13.84%). A total of 970 high-risk couples who could possibly give birth to offspring with thalassemia intermedia or major were identified. In addition, the hematological indices were compared among thalassemia genotypes. Significant differences in MCH, MCV, Hb A, and Hb A2 levels among α-thalassemia minor (α+), trait (α0), and intermediate phenotypes (P < 0.05) and between ßE/ßN and the other ß-thalassemia phenotypes (P < 0.05) were found. Moreover, GAP-PCR and next-generation sequencing further identified 42 rare mutations, 13 of which were first reported in the Chinese population. A novel mutation in the ß-globin gene (HBB: c.246 C > A (rs145669504)) was also discovered. CONCLUSIONS: This study presented a comprehensive analysis of thalassemia variations in a population from Shenzhen and may offer valuable insights for thalassemia control and intervention strategies in this area.

Evaluating sheep hemoglobins with MD simulations as an animal model for sickle cell disease.

Sickle cell disease (SCD) affects millions worldwide, yet there are few therapeutic options. To develop effective treatments, preclinical models that recapitulate human physiology and SCD pathophysiology are needed. SCD arises from a single Glu-to-Val substitution at position 6 in the ß subunit of hemoglobin (Hb), promoting Hb polymerization and subsequent disease. Sheep share important physiological and developmental characteristics with humans, including the same developmental pattern of fetal to adult Hb switching. Herein, we investigated whether introducing the SCD mutation into the sheep ß-globin locus would recapitulate SCD's complex pathophysiology by generating high quality SWISS-MODEL sheep Hb structures and performing MD simulations of normal/sickle human (huHbA/huHbS) and sheep (shHbB/shHbS) Hb, establishing how accurately shHbS mimics huHbS behavior. shHbS, like huHbS, remained stable with low RMSD, while huHbA and shHbB had higher and fluctuating RMSD. shHbB and shHbS also behaved identically to huHbA and huHbS with respect to ß2-Glu6 and ß1-Asp73 (ß1-Asn72 in sheep) solvent interactions. These data demonstrate that introducing the single SCD-causing Glu-to-Val substitution into sheep ß-globin causes alterations consistent with the Hb polymerization that drives RBC sickling, supporting the development of a SCD sheep model to pave the way for alternative cures for this debilitating, globally impactful disease.

Reducing the transcriptional read-through rate of a lentiviral vector for ß-thalassemia gene therapy.

BACKGROUND: LentiGlobin BB305 is a self-inactivating lentiviral vector carrying a human ß-globin expressing cassette for treating ß-thalassemia. Initially, a 2 × 250 bp chicken Locus Control Region fragment of cHS4, functioning as an insulator, was placed at its ΔU3, which was removed after the first clinical trial led by a French team to avoid abnormal splicing, etc. This action could potentially lead to an increasing risk of the transcriptional read-through rate driven by the ß-globin promoter to a significant level, posing a biosafety risk in clinical trials. METHODS: In the present study, a read-through reducing agent (C-U+ or WPRE) was designed to be placed at the 3' UTR of the ß-globin gene. The Enhancer Activities and/or Transcriptional Read-Through (EATRT) rate at the mRNA level and the protein expression level regarding lentiviral preparation titer were examined. RESULTS: We found that the insertion of the element (C-U+ or WPRE) reduced the EATRT effectively by 53% or 41%, respectively. C-U+ has less impact on virus package efficiency. Furthermore, there was no significant difference in the protein expression level after the C-U+ or WPRE insertion. CONCLUSIONS: The results of the present study show that inserting C-U+ or WPRE before the polyA sequence of the BB305 would reduce the EATRT rate at no cost of its expressing efficacy and viral preparation titers. Thus, we present an alternative improvement for a safer lentiviral vector for ß-thalassemia clinical trials.

A synonymous variant is unmasked in thalassaemia.

The genetic underpinnings of beta-thalassaemia encompass a myriad of molecular mechanisms. The ability of synonymous mutations, an often-overlooked category of variants, to influence ß-globin expression and phenotypic disease is highlighted by this report by Gorivale et al. Commentary on: Gorivale et al. When a synonymous mutation breaks the silence in a thalassaemia patient. Br J Haematol 2024;204:677-682.

Global distribution of ß-thalassemia mutations: An update.

One excellent illustration of how a single gene abnormality may result in a spectrum of disease incidence is the incredible phenotypic variety of ß-thalassemia, which spans from severe anemia and transfusion needs to an utterly asymptomatic sickness. However, genetic causes of ß-thalassemia and how the anemia's severity might be altered at various stages in its pathophysiology have been well investigated. There are currently known to be more than 350 mutations that cause genetic disease. However only 20 ß thalassemia mutations account for more than 80% of the ß thalassemia mutation across the globe due to phenomenon of geographical clustering where each population has a few common mutations together with a varying number of rare ones. Due to migration of the population, the spectrum of thalassemia mutation in changing from time to time. In this review, efforts are made to collate ß globin gene mutations in different countries and populations.

A mass spectrometry assay for detection of endogenous and lentiviral engineered hemoglobin in cultured cells and sickle cell disease mice.

Sickle cell disease (SCD) results from a sequence defect in the ß-globin chain of adult hemoglobin (HbA) leading to expression of sickle hemoglobin (HbS). It is traditionally diagnosed by cellulose-acetate hemoglobin electrophoresis or high-performance liquid chromatography. While clinically useful, these methods have both sensitivity and specificity limitations. We developed a novel mass spectrometry (MS) method for the rapid, sensitive and highly quantitative detection of endogenous human ß-globin and sickle hß-globin, as well as lentiviral-encoded therapeutic hßAS3-globin in cultured cells and small quantities of mouse peripheral blood. The MS methods were used to phenotype homozygous HbA (AA), heterozygous HbA-HbS (AS) and homozygous HbS (SS) Townes SCD mice and detect lentiviral vector-encoded hßAS3-globin in transduced mouse erythroid cell cultures and transduced human CD34+ cells after erythroid differentiation. hßAS3-globin was also detected in peripheral blood 6 weeks post-transplant of transduced Townes SS bone marrow cells into syngeneic Townes SS mice and persisted for over 20 weeks post-transplant. As several genome-editing and gene therapy approaches for severe hemoglobin disorders are currently in clinical trials, this MS method will be useful for patient assessment before treatment and during follow-up.

First report of a patient with homozygous hemoglobin Ernz: Evidence to support a non-pathogenic variant.

Hemoglobin Ernz (Hb Ernz) is a missense variant in ß-globin caused by a Threonine to Asparagine substitution at the 123rd amino acid position and HBB c.371C > A in gene level. Hb Ernz has been classified as Uncertain Significance (VUS) by ACMG due to limited reports and the absence of any homozygote genotypes. In our study, we found eight cases of Hb Ernz by DNA sequencing of the ß-globin gene during >20 years of Thalassemia Screening in individuals with borderline hematological parameters who were possible carriers of thalassemia or their spouses. We also report the first homozygote variant of Hb Ernz. Our findings suggest that the changes in hematological parameters observed in individuals with Hb Ernz are likely due to α-globin gene mutations rather than Hb Ernz itself. These findings support the reclassification of Hb Ernz as a benign variant in variant classification.

Therapeutic Effects of Hematopoietic Stem Cell Derived From Gene-Edited Mice on ß654-Thalassemia.

ß-thalassemia is an inherited blood disease caused by reduced or inadequate ß-globin synthesis due to ß-globin gene mutation. Our previous study developed a gene-edited mice model (ß654-ER mice) by CRISPR/Cas9-mediated genome editing, targeting both the ßIVS2-654 (C > T) mutation site and the 3' splicing acceptor site at 579 and corrected abnormal ß-globin mRNA splicing in the ß654-thalassemia mice. Herein, we further explored the therapeutic effect of the hematopoietic stem cells (HSCs) from ß654-ER mice on ß-thalassemia by consecutive HSC transplantation. The results indicated that HSC transplantation derived from gene-edited mice can significantly improve the survival rate of mice after lethal radiation doses and effectively achieve hematopoietic reconstruction and long-term hematopoiesis. Clinical symptoms, including hematologic parameters and tissue pathology of transplanted recipients, were significantly improved compared to the non-transplanted ß654 mice. The therapeutic effect of gene-edited HSC transplantation demonstrated no significant difference in hematological parameters and tissue pathology compared with wild-type mouse-derived HSCs. Our data revealed that HSC transplantation from gene-edited mice completely recovered the ß-thalassemia phenotype. Our study systematically investigated the therapeutic effect of HSCs derived from ß654-ER mice on ß-thalassemia and further confirmed the efficacy of our gene-editing approach. Altogether, it provided a reference and primary experimental data for the clinical usage of such gene-edited HSCs in the future.

Two novel deletion mutations in ß-globin gene cause ß-thalassemia trait in two Chinese families.

BACKGROUND: ß-Thalassemia is mainly caused by point mutations in the ß-globin gene cluster. With the rapid development of sequencing technic, more and more variants are being discovered. RESULTS: In this study, we found two novel deletion mutations in two unrelated families, HBB: c.180delG (termed ßCD59) and HBB: c.382_402delCAGGCTGCCTATCAGAAAGTG (termed ßCD128-134) in family A and B, respectively. Both the two novel mutations lead to ß-thalassemia trait. However, when compounded with other ß0-thalassemia, it may behave with ß-thalassemia intermedia or ß-thalassemia major. CONCLUSION: Our study broadens the variants spectral of ß-thalassemia in Chinese population and provides theoretical guidance for the prenatal diagnosis.

A Rare Heterozygote with a Novel IVS-â ¡-786 (T>A) Mutation on ß-Globin Gene in a Patient with Thalassemia.

BACKGROUND: Thalassemia is an inherited hemolytic blood disease, whose pathogenesis is an imbalance in the expression of hemoglobin. We report a case of a rare ß-globin gene intron mutation for thalassemia patient. METHODS: The blood routine test was performed with an automatic blood cell analyzer. Hb analysis was conducted by hemoglobin (Hb) analyzer. The common ß-thalassemia and α-thalassemia gene mutations were detected by Gap-PCR and fluorescence PCR melting curve, and the rare ß-thalassemia gene mutations were detected by DNA sequencing. RESULTS: A rare heterozygous mutation of ß-globin gene IVS-II-786 (T>A) was found in this case. Blood routine analysis showed the following values: Hb 92 g/L, RBC 4.1 x 1012/L, MCV 74.10 fL, MCH 22.4 pg, MCHC 303 g/L, HCT 0.304 L/L, and RET-He 22.7 pg. Hemoglobin analysis showed values of HbA2 2.2% and HbF < 2% by automatic capillary electrophoresis. The results of gene analysis and DNA sequencing showed that the ß-globin gene IVS-II-786 (T>A) mutation was heterozygous. CONCLUSIONS: The heterozygote of ß-globin gene IVS-II-786 (T>A) mutation was detected for the first time, and the clinical manifestation was moderate anemia. Hemoglobin analysis indicated that the level of HbA2 was decreased. This mutation is relatively rare and easy to misdiagnose in clinical practice. It will provide a new type of evidence and guidance for genetic counseling and clinical treatment of beta thalassemia.

Evaluation of Mono- and Bi-Functional GLOBE-Based Vectors for Therapy of ß-Thalassemia by HBBAS3 Gene Addition and Mutation-Specific RNA Interference.

Therapy via the gene addition of the anti-sickling ßAS3-globin transgene is potentially curative for all ß-hemoglobinopathies and therefore of particular clinical and commercial interest. This study investigates GLOBE-based lentiviral vectors (LVs) for ßAS3-globin addition and evaluates strategies for an increased ß-like globin expression without vector dose escalation. First, we report the development of a GLOBE-derived LV, GLV2-ßAS3, which, compared to its parental vector, adds anti-sickling action and a transcription-enhancing 848-bp transcription terminator element, retains high vector titers and allows for superior ß-like globin expression in primary patient-derived hematopoietic stem and progenitor cells (HSPCs). Second, prompted by our previous correction of HBBIVSI-110(G>A) thalassemia based on RNApol(III)-driven shRNAs in mono- and combination therapy, we analyzed a series of novel LVs for the RNApol(II)-driven constitutive or late-erythroid expression of HBBIVSI-110(G>A)-specific miRNA30-embedded shRNAs (shRNAmiR). This included bifunctional LVs, allowing for concurrent ßAS3-globin expression. LVs were initially compared for their ability to achieve high ß-like globin expression in HBBIVSI-110(G>A)-transgenic cells, before the evaluation of shortlisted candidate LVs in HBBIVSI-110(G>A)-homozygous HSPCs. The latter revealed that ß-globin promoter-driven designs for monotherapy with HBBIVSI-110(G>A)-specific shRNAmiRs only marginally increased ß-globin levels compared to untransduced cells, whereas bifunctional LVs combining miR30-shRNA with ßAS3-globin expression showed disease correction similar to that achieved by the parental GLV2-ßAS3 vector. Our results establish the feasibility of high titers for LVs containing the full HBB transcription terminator, emphasize the importance of the HBB terminator for the high-level expression of HBB-like transgenes, qualify the therapeutic utility of late-erythroid HBBIVSI-110(G>A)-specific miR30-shRNA expression and highlight the exceptional potential of GLV2-ßAS3 for the treatment of severe ß-hemoglobinopathies.

Identification of two novel ß-globin gene mutations HBB: exon3del, HBB: c.-81A>C.

BACKGROUND: ß-thalassemia is a common inherited hemolytic disorder caused by mutations in the HBB gene. Genetic analysis of 2 new beta-thalassemia patients with deletion mutations in the HBB gene and their family members. METHODS: Their clinical presentation and blood phenotypic tests were analyzed. We detected the approximate degree of deletion of these two new HBB gene deletion mutants and analyzed their specific deletion locations by multiplex ligation-dependent probe amplification (MLPA), reverse breakpoint polymerase chain reaction (GAP-PCR), and sanger DNA sequencing. RESULTS: Two new deletion mutants of the HBB gene were identified. First, a 49% decrease in the expression of the third exon of the HBB gene was detected by MLPA testing, and then proband 1 and her mother were found to have HBB: exon3del and proband 2 and her mother to have HBB: c.-81A > C by GAP-PCR and sanger sequencing. CONCLUSION: When the blood phenotype and clinical manifestations do not match the genotype, the presence of new mutants should be considered, and attention should be paid to further testing to avoid missing the diagnosis, which can help in clinical diagnosis and treatment, prenatal diagnosis and genetic counseling.